oral melanotic macule lip Mystery behind labial and macules: Clinical, dermoscopic and pathological aspects of Laugier-Hunziker syndrome Labial melanotic macule

De labiale melanotische maculae (labial melanotic macule) vormen een aparte entiteit

Restraining Factors The market faces challenges including limited clinical standardization across treatment protocols, regulatory scrutiny regarding off-label cosmetic applications, high treatment costs, variability in treatment outcomes, shortage of qualified healthcare professionals, and concerns related to long-term efficacy and safety

H 2 O 2 : hydrogen peroxide

Primers were designed to fit in resulting vector, pJB-HTS upstream of the hexa-histadine tag (5/phos/CCATGGGCAGCAGCCATCATCAT), and downstream (AGCTGGAATTCCTAGTTATTGCTCAGCGGTGGC) (Integrated DNA technologies) of the spacer yielding a fragment containing a phosphorylated 5 end, an initiation codon, a hexa-histadine tag, a thrombin cleavable sequence, a spacer, a termination codon, and an EcoRI site